pSEVA251::PpsbA2*::B0032::CYP110D1 N-terminal His-Tag
(Plasmid
#186708)
-
PurposeN-terminal His-tagged CYP110D1 coding sequence under the control of PpsbA2* promoter and the BBa_B0032 RBS, for the expression in Synechocystis.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186708 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSEVA251
- Backbone size w/o insert (bp) 5303
- Total vector size (bp) 6762
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namealr4766
-
Alt nameCYP110D1
-
SpeciesSynthetic
-
Insert Size (bp)1460
- Promoter PpsbA2*
-
Tag
/ Fusion Protein
- His-Tag (6His) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer gcggataacaatttcacacag
- 3′ sequencing primer gaacaaatccagatggagttc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSEVA251::PpsbA2*::B0032::CYP110D1 N-terminal His-Tag was a gift from Paula Tamagnini (Addgene plasmid # 186708 ; http://n2t.net/addgene:186708 ; RRID:Addgene_186708) -
For your References section:
Light-driven hydroxylation of testosterone by Synechocystis sp. PCC 6803 expressing the heterologous CYP450 monooxygenase CYP110D1. Mascia F, Pereira SB, Pacheco CC, Oliveira P, Solarczek J, Schallmey A, Kourist R, Alphand V and Tamagnini P.. Green Chemistry, 24 (2022):6156 10.1039/D1GC04714K