Skip to main content

pSEVA251::Ptrc.x.tetO2::B0032::CYP110D1 N-terminal His-Tag
(Plasmid #186710)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186710 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSEVA251
  • Backbone size w/o insert (bp) 5303
  • Total vector size (bp) 6777
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    alr4766
  • Alt name
    CYP110D1
  • Species
    Nostoc sp. PCC 7120
  • Insert Size (bp)
    1474
  • Promoter Ptrc.x.tetO2
  • Tag / Fusion Protein
    • His-Tag (6His) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer gcggataacaatttcacacag
  • 3′ sequencing primer gaacaaatccagatggagttc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSEVA251::Ptrc.x.tetO2::B0032::CYP110D1 N-terminal His-Tag was a gift from Paula Tamagnini (Addgene plasmid # 186710 ; http://n2t.net/addgene:186710 ; RRID:Addgene_186710)
  • For your References section:

    Light-driven hydroxylation of testosterone by Synechocystis sp. PCC 6803 expressing the heterologous CYP450 monooxygenase CYP110D1. Mascia F, Pereira SB, Pacheco CC, Oliveira P, Solarczek J, Schallmey A, Kourist R, Alphand V and Tamagnini P.. Green Chemistry, 24 (2022):6156 10.1039/D1GC04714K