hCtRNA_FT
(Plasmid
#186715)
-
PurposeFragment template for DAP array
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186715 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCustom
- Backbone size w/o insert (bp) 2216
- Total vector size (bp) 2367
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA scaffold and hCtRNA
-
Alt nameGP3.4
-
SpeciesSynthetic
-
Insert Size (bp)151
- Promoter hCtRNA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAAATAGGGGTTCCGCGCACAT
- 3′ sequencing primer GAAGGGAGAAAGGCGGACAGGT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hCtRNA_FT was a gift from Xue Gao (Addgene plasmid # 186715 ; http://n2t.net/addgene:186715 ; RRID:Addgene_186715) -
For your References section:
Multiplex base- and prime-editing with drive-and-process CRISPR arrays. Yuan Q, Gao X. Nat Commun. 2022 May 19;13(1):2771. doi: 10.1038/s41467-022-30514-1. 10.1038/s41467-022-30514-1 PubMed 35589728