pMpGE_En03-sgRNA_Target2 (Mpphot)
(Plasmid
#186727)
-
PurposeGateway entry vector for sgRNA (target 2: Mpphot [negative control]). Transient expression of sgRNA (target 2: Mpphot) in plant cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186727 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMpGE_En03
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA_Mphot
-
Alt namesgRNA_Target2
-
gRNA/shRNA sequenceGAAACACACCTTCGGGCGCC
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMpGE_En03-sgRNA_Target2 (Mpphot) was a gift from Yutaka Kodama (Addgene plasmid # 186727 ; http://n2t.net/addgene:186727 ; RRID:Addgene_186727) -
For your References section:
SKLPT imaging: Efficient in vivo pre-evaluation of genome-editing modules using fluorescent protein with peroxisome targeting signal. Konno R, Tanaka H, Kodama Y. Biochem Biophys Res Commun. 2018 Sep 3;503(1):235-241. doi: 10.1016/j.bbrc.2018.06.008. Epub 2018 Jun 12. 10.1016/j.bbrc.2018.06.008 PubMed 29885839