Skip to main content

px459-H3f3b KO sgRNA
(Plasmid #186941)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186941 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    px459
  • Backbone size w/o insert (bp) 9174
  • Total vector size (bp) 9194
  • Vector type
    Mammalian Expression, Mouse Targeting, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    H3f3b KO sgRNA
  • gRNA/shRNA sequence
    TCCTAGCGGTCTGCTTGGTT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    H3f3b (a.k.a. 9430068D06Rik, H3-3a, H3-3b, H3.3B)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (not destroyed)
  • 3′ cloning site BbsI (not destroyed)
  • 5′ sequencing primer TTTATGGCGAGGCGGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px459-H3f3b KO sgRNA was a gift from Zhiguo Zhang (Addgene plasmid # 186941 ; http://n2t.net/addgene:186941 ; RRID:Addgene_186941)
  • For your References section:

    Stable inheritance of H3.3-containing nucleosomes during mitotic cell divisions. Xu X, Duan S, Hua X, Li Z, He R, Zhaang Z. Nat Commun. 2022 May 6;13(1):2514. doi: 10.1038/s41467-022-30298-4. 10.1038/s41467-022-30298-4 PubMed 35523900