pRRL-pEF-H2B-mCherry-T2A-rTetR-DNMT3L-SV40
(Plasmid
#186967)
-
PurposeLentiviral vector encoding DNMT3A recruiter for methylation reporter (pEF-H2B-mCherry-T2A-rTetR-DNMT3L-SV40) for expression in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186967 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRRL
- Backbone size w/o insert (bp) 5474
- Total vector size (bp) 10135
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersmCherry (fluorescence)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDNMT3L
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)4713
-
GenBank IDNM_175867.2
-
Entrez GeneDNMT3L
- Promoter EF-1alpha promoter
-
Tag
/ Fusion Protein
- rTetR fusion (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer cPPT-SF ATAGTAGACATAATAGCAACAGACATAC
- 3′ sequencing primer SV40-SF GGTACCAGGTAAGTGTACCCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypEF-H2B-mCherry-T2A-rTetR and SV40 were amplified from pEX1-pEF-H2B-mCherry-T2A-rTetR-KRAB, a gift from M. Elowitz (Addgene #78348). DNMT3L was amplified from pcDNA3/Myc-DNMT3L, a gift from A. Riggs (Addgene #35523). The pRRL vector backbone was prepared by restriction digest of LT3REVIR, a gift from J. Zuber (Addgene #111176).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL-pEF-H2B-mCherry-T2A-rTetR-DNMT3L-SV40 was a gift from Brian Liau (Addgene plasmid # 186967 ; http://n2t.net/addgene:186967 ; RRID:Addgene_186967) -
For your References section:
Base editor scanning charts the DNMT3A activity landscape. Lue NZ, Garcia EM, Ngan KC, Lee C, Doench JG, Liau BB. Nat Chem Biol. 2023 Feb;19(2):176-186. doi: 10.1038/s41589-022-01167-4. Epub 2022 Oct 20. 10.1038/s41589-022-01167-4 PubMed 36266353