Skip to main content

pGGG-Sr43
(Plasmid #186974)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186974 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGGG-AH-NotI/PmeI
  • Backbone manufacturer
    Hayta et al (2019) https://doi.org/10.1186/s13007-019-0503-z
  • Backbone size w/o insert (bp) 5728
  • Total vector size (bp) 19261
  • Vector type
    Bacterial Expression, Plant Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Please note plasmid requires the helper plasmid, pSOUP (Addgene ID # 165419) for replication in Agrobacterium
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sr43
  • Species
    Thinopyrum ponticum
  • Insert Size (bp)
    13533
  • Mutation
    None
  • GenBank ID
    ON237711
  • Promoter Natice
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer CCACCCGCCGAATTGATAAC
  • 3′ sequencing primer CCGTAGCCACCATGTTTGAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGGG-Sr43 was a gift from Brande Wulff (Addgene plasmid # 186974 ; http://n2t.net/addgene:186974 ; RRID:Addgene_186974)
  • For your References section:

    The wheat stem rust resistance gene Sr43 encodes an unusual protein kinase. Yu G, Matny O, Gourdoupis S, Rayapuram N, Aljedaani FR, Wang YL, Nurnberger T, Johnson R, Crean EE, Saur IM, Gardener C, Yue Y, Kangara N, Steuernagel B, Hayta S, Smedley M, Harwood W, Patpour M, Wu S, Poland J, Jones JDG, Reuber TL, Ronen M, Sharon A, Rouse MN, Xu S, Holusova K, Bartos J, Molnar I, Karafiatova M, Hirt H, Blilou I, Jaremko L, Dolezel J, Steffenson BJ, Wulff BBH. Nat Genet. 2023 Jun;55(6):921-926. doi: 10.1038/s41588-023-01402-1. Epub 2023 May 22. 10.1038/s41588-023-01402-1 PubMed 37217714
Commonly requested with: