pGGG-Sr43
(Plasmid
#186974)
-
PurposeSr43 is a wheat stem rust resistance gene transferred from tall wheat grass (Thinopyrum ponticum) into bread wheat (Triticum aestivum).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186974 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGGG-AH-NotI/PmeI
-
Backbone manufacturerHayta et al (2019) https://doi.org/10.1186/s13007-019-0503-z
- Backbone size w/o insert (bp) 5728
- Total vector size (bp) 19261
-
Vector typeBacterial Expression, Plant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsPlease note plasmid requires the helper plasmid, pSOUP (Addgene ID # 165419) for replication in Agrobacterium
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSr43
-
SpeciesThinopyrum ponticum
-
Insert Size (bp)13533
-
MutationNone
-
GenBank IDON237711
- Promoter Natice
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer CCACCCGCCGAATTGATAAC
- 3′ sequencing primer CCGTAGCCACCATGTTTGAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.researchsquare.com/article/rs-1820134/v1 for the preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGGG-Sr43 was a gift from Brande Wulff (Addgene plasmid # 186974 ; http://n2t.net/addgene:186974 ; RRID:Addgene_186974) -
For your References section:
The wheat stem rust resistance gene Sr43 encodes an unusual protein kinase. Yu G, Matny O, Gourdoupis S, Rayapuram N, Aljedaani FR, Wang YL, Nurnberger T, Johnson R, Crean EE, Saur IM, Gardener C, Yue Y, Kangara N, Steuernagel B, Hayta S, Smedley M, Harwood W, Patpour M, Wu S, Poland J, Jones JDG, Reuber TL, Ronen M, Sharon A, Rouse MN, Xu S, Holusova K, Bartos J, Molnar I, Karafiatova M, Hirt H, Blilou I, Jaremko L, Dolezel J, Steffenson BJ, Wulff BBH. Nat Genet. 2023 Jun;55(6):921-926. doi: 10.1038/s41588-023-01402-1. Epub 2023 May 22. 10.1038/s41588-023-01402-1 PubMed 37217714