pGGG-Sr43
(Plasmid #186974)

• Purpose: Sr43 is a wheat stem rust resistance gene transferred from tall wheat grass (Thinopyrum ponticum) into bread wheat (Triticum aestivum).
• Depositing Lab: Brande Wulff
• Publication: Yu et al Nat Genet. 2023 Jun;55(6):921-926. doi: 10.1038/s41588-023-01402-1. Epub 2023 May 22.

Backbone

• Vector backbone: pGGG-AH-NotI/PmeI
• Backbone manufacturer: Hayta et al (2019) https://doi.org/10.1186/s13007-019-0503-z
• Backbone size w/o insert (bp): 5728
• Total vector size (bp): 19261
• Vector type: Bacterial Expression, Plant Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Please note plasmid requires the helper plasmid, pSOUP (Addgene ID # 165419) for replication in Agrobacterium
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sr43
• Species: Thinopyrum ponticum
• Insert Size (bp): 13533
• Mutation: None
• GenBank ID: ON237711
• Promoter: Natice
• Tag / Fusion Protein:
  • None

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: CCACCCGCCGAATTGATAAC
• 3′ sequencing primer: CCGTAGCCACCATGTTTGAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.researchsquare.com/article/rs-1820134/v1 for the preprint.