pLKO‐puro‐2A‐mdx4cv‐GFP
(Plasmid
#187053)
-
Purposefluorescent reporter for adenine base editing of mdx4cv point mutation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer TACGGTGGGAGGTCTATATAAGCAGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO‐puro‐2A‐mdx4cv‐GFP was a gift from Renzhi Han (Addgene plasmid # 187053 ; http://n2t.net/addgene:187053 ; RRID:Addgene_187053) -
For your References section:
Efficient precise in vivo base editing in adult dystrophic mice. Xu L, Zhang C, Li H, Wang P, Gao Y, Mokadam NA, Ma J, Arnold WD, Han R. Nat Commun. 2021 Jun 17;12(1):3719. doi: 10.1038/s41467-021-23996-y. 10.1038/s41467-021-23996-y PubMed 34140489