pSLS.400
(Plasmid
#187201)
-
PurposeExpresses retron Eco4 RT
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJKR-O-mphR
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRetron Eco4 Reverse Transcriptase
-
Alt nameRetron Ec83 RT
-
SpeciesE. coli
-
Insert Size (bp)939
- Promoter mphR
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCCAGGCATCAAATTAAGCAG
- 3′ sequencing primer CCGTTGTGGTCTCCCTGAAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A192P mutation in mphR codon optimized does not affect plasmid function.
Please visit https://doi.org/10.1101/2021.08.11.455990 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLS.400 was a gift from Seth Shipman (Addgene plasmid # 187201 ; http://n2t.net/addgene:187201 ; RRID:Addgene_187201) -
For your References section:
Recording gene expression order in DNA by CRISPR addition of retron barcodes. Bhattarai-Kline S, Lear SK, Fishman CB, Lopez SC, Lockshin ER, Schubert MG, Nivala J, Church GM, Shipman SL. Nature. 2022 Aug;608(7921):217-225. doi: 10.1038/s41586-022-04994-6. Epub 2022 Jul 27. 10.1038/s41586-022-04994-6 PubMed 35896746
