1154B_gFLE_pB_VTK_ActG
(Plasmid
#187238)
-
PurposeAn. gambiae transgenesis plasmid. PiggyBac with transposase in backbone. Expresses two gRNAs targeting fle
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187238 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBVTK_ActG
-
Backbone manufacturerna
- Total vector size (bp) 12559
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFemaleless
-
gRNA/shRNA sequenceCGACGGCTCGTTCATCGCTG, ATCGAGCGCGTCGCCTGGTA
-
SpeciesA. gambiae
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1154B_gFLE_pB_VTK_ActG was a gift from Omar Akbari (Addgene plasmid # 187238 ; http://n2t.net/addgene:187238 ; RRID:Addgene_187238) -
For your References section:
A confinable female-lethal population suppression system in the malaria vector, Anopheles gambiae. Smidler AL, Pai JJ, Apte RA, Sanchez C HM, Corder RM, Jeffrey Gutierrez E, Thakre N, Antoshechkin I, Marshall JM, Akbari OS. Sci Adv. 2023 Jul 7;9(27):eade8903. doi: 10.1126/sciadv.ade8903. Epub 2023 Jul 5. 10.1126/sciadv.ade8903 PubMed 37406109