Skip to main content
Addgene

pCMV mouse sidekick2
(Plasmid #18735)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 18735 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1 (EGFP deleted)
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sidekick-2
  • Alt name
    sidekick 2
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Sdk2 (a.k.a. 4632412F08Rik, 5330435L01Rik, Sdk-2, mKIAA1514)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The NdeI-NotI fragment obtained from mKIAA1514 plasmid was cloned into the XhoI and NotI sites of EGFP-N1, and the XhoI-NdeI fragment was replaced by a cDNA amplified with primers GGCCCTCGAGTTATAAAGCAACTCGCAAAGAGG and CTGTTGTAGGCAGCCACCTCGATC.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV mouse sidekick2 was a gift from Joshua Sanes (Addgene plasmid # 18735 ; http://n2t.net/addgene:18735 ; RRID:Addgene_18735)
  • For your References section:

    Dscam and Sidekick proteins direct lamina-specific synaptic connections in vertebrate retina. Yamagata M, Sanes JR. Nature. 2008 Jan 24. 451(7177):465-9. 10.1038/nature06469 PubMed 18216854