ATP1A1_G6_T804N_Std_Dual_epegRNA_tevopreQ1
(Plasmid
#187457)
-
PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 pegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepU6-tevopreq1-GG-acceptor
- Backbone size w/o insert (bp) 3041
- Total vector size (bp) 3438
-
Vector typeMammalian Expression, CRISPR ; Prime editing
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATP1A1 G6 T804N pegRNA
-
gRNA/shRNA sequenceGCAAACATTCCACTACCACT
-
SpeciesH. sapiens (human)
-
Entrez GeneATP1A1 (a.k.a. CMT2DD, HOMGSMR2)
- Promoter Tandem U6 promoters
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGG
- 3′ sequencing primer GGGAAACGCCTGGTATCTTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Prime editing vector derived from pU6-tevopreq1-GG-acceptor. See Nelson et al. Nature Biotechnology (2021) for the detailed epegRNA (tevopreq1) cloning protocol to target your gene of interest. False-positive colonies will appear pink or red if the RFP insert has not been replaced by the new epegRNA cassette.
Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ATP1A1_G6_T804N_Std_Dual_epegRNA_tevopreQ1 was a gift from Yannick Doyon (Addgene plasmid # 187457 ; http://n2t.net/addgene:187457 ; RRID:Addgene_187457) -
For your References section:
Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338