pEGPN-TMPRSS2
(Plasmid
#187484)
-
PurposeExpression vector - TMPRSS2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187484 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 7456
- Total vector size (bp) 8959
-
Vector typeLentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTMPRSS2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1479
-
Entrez GeneTMPRSS2 (a.k.a. PRSS10)
- Promoter EFS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTAACTCGAACGCTAGCTGTGCGATCGTTT
- 3′ sequencing primer AGGCCTCGGGATTCCTAGGAACAGCGGTTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGPN-TMPRSS2 was a gift from Lewis Cantley (Addgene plasmid # 187484 ; http://n2t.net/addgene:187484 ; RRID:Addgene_187484) -
For your References section:
Coagulation factors directly cleave SARS-CoV-2 spike and enhance viral entry. Kastenhuber ER, Mercadante M, Nilsson-Payant B, Johnson JL, Jaimes JA, Muecksch F, Weisblum Y, Bram Y, Chandar V, Whittaker GR, tenOever BR, Schwartz RE, Cantley L. Elife. 2022 Mar 23;11. pii: 77444. doi: 10.7554/eLife.77444. 10.7554/eLife.77444 PubMed 35294338
Map uploaded by the depositor.
