pMBEC8
              
              
                (Plasmid
                
                #187599)
              
            
            
            
          - 
            PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Apramycin resistance
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187599 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepnCas9PA-BEC
- 
              Backbone manufacturerQuanjiang Ji (Addgene plasmid # 113349)
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 12200
- 
              Vector typeBacterial Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Apramycin, 25 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert namenCas9-BEC-UGI; cas6f, gfp
- 
                  Alt namecsy4
- Promoter trc
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTAGACTCTCGTTTGGATTGC
- 3′ sequencing primer ACTGCCGGTTCTCCGAATTGCAG (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pMBEC8 was a gift from Pablo Ivan Nikel (Addgene plasmid # 187599 ; http://n2t.net/addgene:187599 ; RRID:Addgene_187599)
- 
                For your References section: Modular (de)construction of complex bacterial phenotypes by CRISPR/nCas9-assisted, multiplex cytidine base-editing. Volke DC, Martino RA, Kozaeva E, Smania AM, Nikel PI. Nat Commun. 2022 May 31;13(1):3026. doi: 10.1038/s41467-022-30780-z. 10.1038/s41467-022-30780-z PubMed 35641501
