Skip to main content

pMBEC8
(Plasmid #187599)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187599 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pnCas9PA-BEC
  • Backbone manufacturer
    Quanjiang Ji (Addgene plasmid # 113349)
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 12200
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Apramycin, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nCas9-BEC-UGI; cas6f, gfp
  • Alt name
    csy4
  • Promoter trc

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTAGACTCTCGTTTGGATTGC
  • 3′ sequencing primer ACTGCCGGTTCTCCGAATTGCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMBEC8 was a gift from Pablo Ivan Nikel (Addgene plasmid # 187599 ; http://n2t.net/addgene:187599 ; RRID:Addgene_187599)
  • For your References section:

    Modular (de)construction of complex bacterial phenotypes by CRISPR/nCas9-assisted, multiplex cytidine base-editing. Volke DC, Martino RA, Kozaeva E, Smania AM, Nikel PI. Nat Commun. 2022 May 31;13(1):3026. doi: 10.1038/s41467-022-30780-z. 10.1038/s41467-022-30780-z PubMed 35641501