px552-sg-gria1-HT-SEP
(Plasmid
#187653)
-
PurposeContains HaloTag-SEP to be inserted into the NTD of Gria1 (via HITI) and single guide RNA to target Cas9 to Gria1 under control of the U6 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187653 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepx552-sg-gria1-HT
- Backbone size w/o insert (bp) 3293
- Total vector size (bp) 5031
-
Modifications to backboneSynapsin promoter and miRFP670 removed
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloTag-SEP donor
-
SpeciesSynthetic
-
Insert Size (bp)1736
- Promoter N/A
-
Tag
/ Fusion Protein
- N/A
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer ggctagtccgttatcaacttg
- 3′ sequencing primer tcaccaggtgtacatcatgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px552-sg-gria1-HT-SEP was a gift from Erin O'Shea (Addgene plasmid # 187653 ; http://n2t.net/addgene:187653 ; RRID:Addgene_187653) -
For your References section:
Plasticity-induced actin polymerization in the dendritic shaft regulates intracellular AMPA receptor trafficking. Wong VC, Houlihan PR, Liu H, Walpita D, DeSantis MC, Liu Z, O'Shea EK. Elife. 2024 Aug 15;13:e80622. doi: 10.7554/eLife.80622. 10.7554/eLife.80622 PubMed 39146380