pET28a-nGFPMNase
(Plasmid
#187826)
-
Purposeexpress nGFPMNase protein in E coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187826 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 6166
-
Vector typeBacterial Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namenGFPMNASE
-
SpeciesSynthetic
-
Insert Size (bp)852
- Promoter T7 Promotor
-
Tag
/ Fusion Protein
- his tag (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GAGCGGATAACAATTCCCCT
- 3′ sequencing primer AGGCCCCAAGGGGTTATGCT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-nGFPMNase was a gift from Yikang Rong (Addgene plasmid # 187826 ; http://n2t.net/addgene:187826 ; RRID:Addgene_187826) -
For your References section:
Elevation of D4 dopamine receptor mRNA in postmortem schizophrenic brain. Stefanis NC, Bresnick JN, Kerwin RW, Schofield WN, McAllister G. Brain Res Mol Brain Res. 1998 Jan;53(1-2):112-9. doi: 10.1016/s0169-328x(97)00285-4. 10.1016/s0169-328x(97)00285-4 PubMed 9473618