pBlueKan+cysMPro
(Plasmid
#187879)
-
Purpose(Empty Backbone) Escherichia coli plasmid containing unique cloning sites behind a Campylobacter jejuni cysM promoter. Cloned genes will be expressed from the constitutively expressed C. jejuni promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187879 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescript KS(+)
-
Backbone manufacturerStratagene (Agilent Tech)
- Backbone size (bp) 2864
-
Modifications to backboneNotI restriction site, aph(3) gene (kanamycin resistance) of C. jejuni RM1188, the cysM promoter region of C. jejuni CDC9511, SmaI/XhoI/NotI restriction sites added in tandem
-
Vector typeBacterial Expression
- Promoter CysM
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aattgttttagtaccccatcagttttattggttttggtactttttcaactc
- 3′ sequencing primer cgcctcgagcccgggaattttaatatccttttttgtttaataatgatagttttataaaag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBlueKan+cysMPro was a gift from Gaylen Uhlich (Addgene plasmid # 187879 ; http://n2t.net/addgene:187879 ; RRID:Addgene_187879) -
For your References section:
Cloning vectors for gene delivery, integration and expression in Campylobacter jejuni. Uhlich GA, Bagi L, Gunther NW 4th. Biotechniques. 2022 Apr 13. doi: 10.2144/btn-2021-0096. 10.2144/btn-2021-0096 PubMed 35416085