Skip to main content
Addgene

pBlueKan+cysMPro
(Plasmid #187879)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187879 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescript KS(+)
  • Backbone manufacturer
    Stratagene (Agilent Tech)
  • Backbone size (bp) 2864
  • Modifications to backbone
    NotI restriction site, aph(3) gene (kanamycin resistance) of C. jejuni RM1188, the cysM promoter region of C. jejuni CDC9511, SmaI/XhoI/NotI restriction sites added in tandem
  • Vector type
    Bacterial Expression
  • Promoter CysM

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aattgttttagtaccccatcagttttattggttttggtactttttcaactc
  • 3′ sequencing primer cgcctcgagcccgggaattttaatatccttttttgtttaataatgatagttttataaaag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBlueKan+cysMPro was a gift from Gaylen Uhlich (Addgene plasmid # 187879 ; http://n2t.net/addgene:187879 ; RRID:Addgene_187879)
  • For your References section:

    Cloning vectors for gene delivery, integration and expression in Campylobacter jejuni. Uhlich GA, Bagi L, Gunther NW 4th. Biotechniques. 2022 Apr 13. doi: 10.2144/btn-2021-0096. 10.2144/btn-2021-0096 PubMed 35416085