Skip to main content

pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
(Plasmid #187945)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187945 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSLPB2
  • Backbone size w/o insert (bp) 5702
  • Total vector size (bp) 11406
  • Vector type
    Mammalian Expression, Synthetic Biology ; piggyBac
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpdCas9-tagRFPt-P2A-tagBFP
  • Alt name
    S. pyogenes Cas9 (D10A; N863A)
  • Species
    Synthetic; S. pyogenes
  • Insert Size (bp)
    5724
  • Tags / Fusion Proteins
    • tagRFPt (C terminal on insert)
    • P2A (C terminal on insert)
    • tagBFP (C terminal on insert)
    • NLS (N terminal on insert)
    • NLS + HA-tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCTAGAGCTAGCGAATTCAGAGC
  • 3′ sequencing primer GGCACCTTCCAGGGTCAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The piggyBac backbone was derived from a plasmid kindly donated by Luca Giorgetti.

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin was a gift from Edda Schulz (Addgene plasmid # 187945 ; http://n2t.net/addgene:187945 ; RRID:Addgene_187945)
  • For your References section:

    CasTuner is a degron and CRISPR/Cas-based toolkit for analog tuning of endogenous gene expression. Noviello G, Gjaltema RAF, Schulz EG. Nat Commun. 2023 Jun 3;14(1):3225. doi: 10.1038/s41467-023-38909-4. 10.1038/s41467-023-38909-4 PubMed 37270532