pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
(Plasmid
#187945)
-
PurposedCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSLPB2
- Backbone size w/o insert (bp) 5702
- Total vector size (bp) 11406
-
Vector typeMammalian Expression, Synthetic Biology ; piggyBac
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpdCas9-tagRFPt-P2A-tagBFP
-
Alt nameS. pyogenes Cas9 (D10A; N863A)
-
SpeciesSynthetic; S. pyogenes
-
Insert Size (bp)5724
-
Tags
/ Fusion Proteins
- tagRFPt (C terminal on insert)
- P2A (C terminal on insert)
- tagBFP (C terminal on insert)
- NLS (N terminal on insert)
- NLS + HA-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCTAGAGCTAGCGAATTCAGAGC
- 3′ sequencing primer GGCACCTTCCAGGGTCAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe piggyBac backbone was derived from a plasmid kindly donated by Luca Giorgetti.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.05.511019v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin was a gift from Edda Schulz (Addgene plasmid # 187945 ; http://n2t.net/addgene:187945 ; RRID:Addgene_187945) -
For your References section:
CasTuner is a degron and CRISPR/Cas-based toolkit for analog tuning of endogenous gene expression. Noviello G, Gjaltema RAF, Schulz EG. Nat Commun. 2023 Jun 3;14(1):3225. doi: 10.1038/s41467-023-38909-4. 10.1038/s41467-023-38909-4 PubMed 37270532