pSLPB2B-FKBP12_F36V-SpdCas9-hHDAC4-tagBFP-PGK-Blasticidin
(Plasmid
#187954)
-
PurposeFKBP12 (F36V mutant) degron-tagged dCas9-hHDAC4 fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.
-
Depositing Lab
-
Depositing OrganizationMax Planck Institute for Molecular Genetics
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187954 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 187954-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 187954-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSLPB2-FKBP_F36V-SpdCas9-tagBFP-PGK-Blasticidin
- Backbone size w/o insert (bp) 11406
- Total vector size (bp) 14263
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFKBP12_F36V-SpdCas9-hHDAC4-tagBFP
-
Alt nameS. pyogenes Cas9 (D10A; N863A)
-
Alt nameFKBP12 (F36V mutant)
-
Alt namehuman Histon Deacetylase 4
-
SpeciesH. sapiens (human), Synthetic; S. pyogenes
-
Insert Size (bp)3292
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCTCCCAAAGCCATCCAGA
- 3′ sequencing primer CGCTACCTCCTCCTCCGCTT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe hHDAC4 domain was amplified from pEx1-pEF-H2B-mCherry-T2A-rTetR-HDAC4, which was a gift from Michael Elowitz (Addgene plasmid # 78349 ; http://n2t.net/addgene:78349 ; RRID:Addgene_78349).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.05.511019v1 for bioRxiv preprint.
DNA (Catalog # 187954-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 187954-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLPB2B-FKBP12_F36V-SpdCas9-hHDAC4-tagBFP-PGK-Blasticidin was a gift from Edda Schulz (Addgene plasmid # 187954 ; http://n2t.net/addgene:187954 ; RRID:Addgene_187954) -
For your References section:
CasTuner is a degron and CRISPR/Cas-based toolkit for analog tuning of endogenous gene expression. Noviello G, Gjaltema RAF, Schulz EG. Nat Commun. 2023 Jun 3;14(1):3225. doi: 10.1038/s41467-023-38909-4. 10.1038/s41467-023-38909-4 PubMed 37270532