pSLPB3B-mAID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
(Plasmid
#187963)
-
PurposemAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187963 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSLPB3B-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-OsTIR1
- Backbone size w/o insert (bp) 11406
- Total vector size (bp) 13480
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
-
Alt nameS. pyogenes Cas9 (D10A; N863A)
-
Alt namemini Auxin inducible degron (mAID)
-
SpeciesA. thaliana (mustard weed), Synthetic; S. pyogenes
-
Insert Size (bp)216
-
Tag
/ Fusion Protein
- GGS linker (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGACCTTGTGCAGAACT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameosTIR1
-
Alt nameOryza sativa TIR1
-
Insert Size (bp)1722
-
Tag
/ Fusion Protein
- T2A (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGAAGAGTGCTTGTCCTAAAG
- 3′ sequencing primer TTTATACATCCTCAAATCGATTTTCCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe mAID degron domain was amplified from pcDNA5-H2B-AID-EYFP, a gift from Don Cleveland (Addgene plasmid # 47329 ; http://n2t.net/addgene:47329 ; RRID:Addgene_47329). The OsTIR1 protein employed for the AID and mAID degron systems was amplified from pMK232 (CMV-OsTIR1-PURO), which was a gift from Masato Kanemaki (Addgene plasmid # 72834 ; http://n2t.net/addgene:72834 ; RRID:Addgene_72834)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.05.511019v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLPB3B-mAID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1 was a gift from Edda Schulz (Addgene plasmid # 187963 ; http://n2t.net/addgene:187963 ; RRID:Addgene_187963) -
For your References section:
CasTuner is a degron and CRISPR/Cas-based toolkit for analog tuning of endogenous gene expression. Noviello G, Gjaltema RAF, Schulz EG. Nat Commun. 2023 Jun 3;14(1):3225. doi: 10.1038/s41467-023-38909-4. 10.1038/s41467-023-38909-4 PubMed 37270532