pSLPB3B-mAID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
(Plasmid #187963)

• Purpose: mAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.
• Depositing Lab: Edda Schulz
• Publication: Noviello et al Nat Commun. 2023 Jun 3;14(1):3225. doi: 10.1038/s41467-023-38909-4.

Backbone

• Vector backbone: pSLPB3B-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-OsTIR1
• Backbone size w/o insert (bp): 11406
• Total vector size (bp): 13480
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: AID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
• Alt name: S. pyogenes Cas9 (D10A; N863A)
• Alt name: mini Auxin inducible degron (mAID)
• Species: A. thaliana (mustard weed), Synthetic; S. pyogenes
• Insert Size (bp): 216
• Tag / Fusion Protein:
  • GGS linker (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGGACCTTGTGCAGAACT

Gene/Insert 2

• Gene/Insert name: osTIR1
• Alt name: Oryza sativa TIR1
• Insert Size (bp): 1722
• Tag / Fusion Protein:
  • T2A (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGAAGAGTGCTTGTCCTAAAG
• 3′ sequencing primer: TTTATACATCCTCAAATCGATTTTCCT

Resource Information

• Supplemental Documents:
  • pSLPB3B-NLS-mAID-linker-dCas9-tagRFPt-P2A-tagBFP-pGK-Blasticidin-T2A-osTIR Bv3.gb
• A portion of this plasmid was derived from a plasmid made by: The mAID degron domain was amplified from pcDNA5-H2B-AID-EYFP, a gift from Don Cleveland (Addgene plasmid # 47329 ; http://n2t.net/addgene:47329 ; RRID:Addgene_47329). The OsTIR1 protein employed for the AID and mAID degron systems was amplified from pMK232 (CMV-OsTIR1-PURO), which was a gift from Masato Kanemaki (Addgene plasmid # 72834 ; http://n2t.net/addgene:72834 ; RRID:Addgene_72834)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.10.05.511019v1 for bioRxiv preprint.