Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GBH-2aG4-insGFP.2
(Plasmid #188029)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 188029 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pKTol2-SE
  • Backbone manufacturer
    K.Clark
  • Backbone size w/o insert (bp) 7200
  • Vector type
    Targetable insertional mutagen and reporter system

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Targeted 2aGal4VP16 protein trap; secondary marker insulin GFP
  • Species
    D. rerio (zebrafish)
  • Promoter Endogenuous Promoter; insulin promotor

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BfuaI (unknown if destroyed)
  • 3′ cloning site BspQI (unknown if destroyed)
  • 5′ sequencing primer SEQ-pk-F1: TGTATTACTGTTTATGTAAGCAGACA
  • 3′ sequencing primer SEQ-pk-R1: AGCGAGTCAGTGAGCGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is designed to have homology domains cloned into the 5' end and 3' end. Bfuai is used to clone in the 5' homology domain, while BspQi is used to clone in the 3' homology domain.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GBH-2aG4-insGFP.2 was a gift from Karl Clark (Addgene plasmid # 188029 ; http://n2t.net/addgene:188029 ; RRID:Addgene_188029)