pGL4.23-Gja1prom
(Plasmid
#188114)
-
PurposeExpresses luciferase under control of Gja1 promoter in transfected cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188114 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL4.23
- Backbone size w/o insert (bp) 4283
- Total vector size (bp) 4691
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGja1 promoter
-
Alt nameCx43
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)503
-
Entrez GeneGja1 (a.k.a. Cnx43, Cx43, Cx43alpha1, Cxnk1, Gja-1, Npm1, connexin43)
- Promoter Gja1 endogenous promoter up to gene start codon
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer TCTCCTGAAGGAATGACCCATCCA
- 3′ sequencing primer GTCTGGGCACCTCTCTTTCACT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloning by Virlana M Shchuka.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.23-Gja1prom was a gift from Jennifer Mitchell (Addgene plasmid # 188114 ; http://n2t.net/addgene:188114 ; RRID:Addgene_188114) -
For your References section:
MYB and ELF3 differentially modulate labor-inducing gene expression in myometrial cells. Shchuka VM, Khader N, Dorogin A, Shynlova O, Mitchell JA. PLoS One. 2023 Jan 3;18(1):e0271081. doi: 10.1371/journal.pone.0271081. eCollection 2023. 10.1371/journal.pone.0271081 PubMed 36595497