Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGL4.23-Gja1prom
(Plasmid #188114)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 188114 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL4.23
  • Backbone size w/o insert (bp) 4283
  • Total vector size (bp) 4691
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gja1 promoter
  • Alt name
    Cx43
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    503
  • Entrez Gene
    Gja1 (a.k.a. Cnx43, Cx43, Cx43alpha1, Cxnk1, Gja-1, Npm1, connexin43)
  • Promoter Gja1 endogenous promoter up to gene start codon

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer TCTCCTGAAGGAATGACCCATCCA
  • 3′ sequencing primer GTCTGGGCACCTCTCTTTCACT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cloning by Virlana M Shchuka.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.23-Gja1prom was a gift from Jennifer Mitchell (Addgene plasmid # 188114 ; http://n2t.net/addgene:188114 ; RRID:Addgene_188114)
  • For your References section:

    MYB and ELF3 differentially modulate labor-inducing gene expression in myometrial cells. Shchuka VM, Khader N, Dorogin A, Shynlova O, Mitchell JA. PLoS One. 2023 Jan 3;18(1):e0271081. doi: 10.1371/journal.pone.0271081. eCollection 2023. 10.1371/journal.pone.0271081 PubMed 36595497