pCW57-Cx46-IRES-GCaMP6s
(Plasmid
#188238)
-
Purpose3rd generation, inducible bicistronic lentiviral plasmid for expression of human connexin 46 and GCaMP6s
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188238 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcW57.1
-
Backbone manufacturerAddgene, plasmid 41393
- Backbone size w/o insert (bp) 7611
- Total vector size (bp) 9345
-
Modifications to backbone1743 bp removed (from 267 to 2009)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGJA3
-
Alt nameCx46
-
SpeciesH. sapiens (human)
-
GenBank IDNM_021954.4
-
Entrez GeneGJA3 (a.k.a. CTRCT14, CX46, CZP3)
- Promoter Tight TRE promoter
-
Tag
/ Fusion Protein
- GCaMp6s (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site Mlul (unknown if destroyed)
- 5′ sequencing primer AGAGCTCGTTTAGTGAACCG
- 3′ sequencing primer GTTTCCGGGCCCTCACATTGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGJA3 was gene-synthesised by Bio-Fab Research, https://www.biofabresearch.com/en/
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57-Cx46-IRES-GCaMP6s was a gift from Fabio Mammano (Addgene plasmid # 188238 ; http://n2t.net/addgene:188238 ; RRID:Addgene_188238) -
For your References section:
A Quantitative Assay for Ca(2+) Uptake through Normal and Pathological Hemichannels. Nardin C, Tettey-Matey A, Donati V, Marazziti D, Di Pietro C, Peres C, Raspa M, Zonta F, Yang G, Gorelik M, Singh S, Cardarelli L, Sidhu SS, Mammano F. Int J Mol Sci. 2022 Jun 30;23(13). pii: ijms23137337. doi: 10.3390/ijms23137337. 10.3390/ijms23137337 PubMed 35806342