Skip to main content

p426-Cup1p-FusionRed
(Plasmid #188392)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188392 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    426Gal-FUS-YFP (addgene #29592)
  • Backbone manufacturer
    Aaron Gitler
  • Backbone size w/o insert (bp) 6149
  • Total vector size (bp) 6848
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FusionRed
  • Alt name
    Red Fluorescent protein
  • Species
    Entacmaea quadricolor
  • Insert Size (bp)
    699
  • Promoter CUP1 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer CAGGAAACAGCTATGAC
  • 3′ sequencing primer GACCTAGACTTCAGGTTGTCTAACTCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    FUS-FusionRed-PixD was a gift from Jared Toettcher (Addgene plasmid # 111503 ; http://n2t.net/addgene:111503 ; RRID:Addgene_111503)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p426-Cup1p-FusionRed was a gift from Michihiko Kataoka (Addgene plasmid # 188392 ; http://n2t.net/addgene:188392 ; RRID:Addgene_188392)
  • For your References section:

    Foci-forming regions of pyruvate kinase and enolase at the molecular surface incorporate proteins into yeast cytoplasmic metabolic enzymes transiently assembling (META) bodies. Utsumi R, Murata Y, Ito-Harashima S, Akai M, Miura N, Kuroda K, Ueda M, Kataoka M. PLoS One. 2023 Apr 13;18(4):e0283002. doi: 10.1371/journal.pone.0283002. eCollection 2023. 10.1371/journal.pone.0283002 PubMed 37053166