pGP8GF-ZmAFB2/3 a
(Plasmid
#188423)
-
PurposeZea Mays Nuclear Auxin Signaling Receptor AFB2/3 A
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGP8GF
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAuxin Signaling Receptor AFB2/3 a
-
SpeciesZea Mays
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAAATTAAAGCCTTCGAGCGTCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGP8GF-ZmAFB2/3 a was a gift from Britney Moss (Addgene plasmid # 188423 ; http://n2t.net/addgene:188423 ; RRID:Addgene_188423) -
For your References section:
A Synthetic Approach Allows Rapid Characterization of the Maize Nuclear Auxin Response Circuit. Ramos Baez R, Buckley Y, Yu H, Chen Z, Gallavotti A, Nemhauser JL, Moss BL. Plant Physiol. 2020 Apr;182(4):1713-1722. doi: 10.1104/pp.19.01475. Epub 2020 Mar 2. 10.1104/pp.19.01475 PubMed 32123041