Skip to main content
Addgene

K365-iLid
(Plasmid #188456)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188456 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pT7-7
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kinesin 1-365
  • Alt name
    Kinesin heavy chain
  • Alt name
    K365-iLid-H6
  • Species
    D. melanogaster (fly)
  • Mutation
    Kinesin amino acids 1-365
  • Entrez Gene
    Khc (a.k.a. Dmel_CG7765, 2R6, CG7765, DK, DKH, Dm KHC, DmK, DmKHC, Dmel\CG7765, Dmkin, KHC, KIF 5A, KIF5, KIF5B, KIN, Kif5, Kin, Kin-1, Kinesin, Kinesin-1, khc, kin, kinesin, kinesin-1, l(2)W12, l(2)k13219, l(2)k13314, l(2R)W12, pgs)
  • Promoter T7
  • Tags / Fusion Proteins
    • iLid (C terminal on insert)
    • 6xHis (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACGCCCGACTAAAGGGTAAGCGCAAGGCCggtagtggt
  • 3′ sequencing primer CTTACCCTTTAGTCGGGCGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    K365-iLid was a gift from Zvonimir Dogic (Addgene plasmid # 188456 ; http://n2t.net/addgene:188456 ; RRID:Addgene_188456)
  • For your References section:

    Spatio-temporal patterning of extensile active stresses in microtubule-based active fluids. Lemma LM, Varghese M, Ross TD, Thomson M, Baskaran A, Dogic Z. PNAS Nexus. 2023 Apr 12;2(5):pgad130. doi: 10.1093/pnasnexus/pgad130. eCollection 2023 May. 10.1093/pnasnexus/pgad130 PubMed 37168671