K365-iLid
(Plasmid
#188456)
-
PurposeComponent of optically-induced motor dimerization system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188456 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepT7-7
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKinesin 1-365
-
Alt nameKinesin heavy chain
-
Alt nameK365-iLid-H6
-
SpeciesD. melanogaster (fly)
-
MutationKinesin amino acids 1-365
-
Entrez GeneKhc (a.k.a. Dmel_CG7765, 2R6, CG7765, DK, DKH, Dm KHC, DmK, DmKHC, Dmel\CG7765, Dmkin, KHC, KIF 5A, KIF5, KIF5B, KIN, Kif5, Kin, Kin-1, Kinesin-1, khc, kin, kinesin, kinesin-1, l(2)W12, l(2)k13219, l(2)k13314, l(2R)W12, pgs)
- Promoter T7
-
Tags
/ Fusion Proteins
- iLid (C terminal on insert)
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGCCCGACTAAAGGGTAAGCGCAAGGCCggtagtggt
- 3′ sequencing primer CTTACCCTTTAGTCGGGCGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
K365-iLid was a gift from Zvonimir Dogic (Addgene plasmid # 188456 ; http://n2t.net/addgene:188456 ; RRID:Addgene_188456) -
For your References section:
Spatio-temporal patterning of extensile active stresses in microtubule-based active fluids. Lemma LM, Varghese M, Ross TD, Thomson M, Baskaran A, Dogic Z. PNAS Nexus. 2023 Apr 12;2(5):pgad130. doi: 10.1093/pnasnexus/pgad130. eCollection 2023 May. 10.1093/pnasnexus/pgad130 PubMed 37168671