pOttc1501 - pscAAV CMV-IE hCDNF
(Plasmid
#188538)
-
PurposeAn AAV packaging vector that expresses hCDNF under control of the CMV-IE promoter.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188538 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePottc1491 - pscAAV CMV-IE iRFP-FLAG
-
Backbone manufacturerNIDA GEVVC
- Backbone size w/o insert (bp) 3747
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehCDNF
-
SpeciesH. sapiens (human)
-
Insert Size (bp)564
-
Entrez GeneCDNF (a.k.a. ARMETL1)
- Promoter CMV-IE
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV-Forward CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer bGHpA R30 GGCTGGCAACTAGAAGGCAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNIDA GEVVC
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOttc1501 - pscAAV CMV-IE hCDNF was a gift from Brandon Harvey (Addgene plasmid # 188538 ; http://n2t.net/addgene:188538 ; RRID:Addgene_188538)