Mammalian_SpCas9_Target-AID3S
(Plasmid
#188649)
-
PurposeExpresses SpCas9_Target-AID3S in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188649 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenCas9-AID3S-UGI
-
SpeciesSynthetic; Streptococcus pyogenes
-
Insert Size (bp)5175
-
MutationD10A for SpCas9
-
GenBank IDOYN72315.1 ABO15149.1
- Promoter pCMV
-
Tag
/ Fusion Protein
- UGI
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCACCAAAATCAACGGGA
- 3′ sequencing primer GCCCCAGCTGGTTCTTTCCGCCTCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Mammalian_SpCas9_Target-AID3S was a gift from Keiji Nishida (Addgene plasmid # 188649 ; http://n2t.net/addgene:188649 ; RRID:Addgene_188649) -
For your References section:
Cytosine base editing systems with minimized off-target effect and molecular size. Li A, Mitsunobu H, Yoshioka S, Suzuki T, Kondo A, Nishida K. Nat Commun. 2022 Aug 8;13(1):4531. doi: 10.1038/s41467-022-32157-8. 10.1038/s41467-022-32157-8 PubMed 35941130