ipUSEPR-sg-Hs-PHGDH-int2
              
              
                (Plasmid
                
                #188682)
              
            
            
            
          - 
            Purposecontrol sgRNA
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188682 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLenti
- 
              Vector typeLentiviral, CRISPR
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature30°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert namesgPHGDH intron control
- 
                    gRNA/shRNA sequenceGGTCTCTAGGGCAACCTCCA
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)20
- 
                  MutationWT
- 
                        Entrez GenePHGDH (a.k.a. 3-PGDH, 3PGDH, HEL-S-113, NLS, NLS1, PDG, PGAD, PGD, PGDH, PHGDHD, SERA)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: ipUSEPR-sg-Hs-PHGDH-int2 was a gift from Lewis Cantley (Addgene plasmid # 188682 ; http://n2t.net/addgene:188682 ; RRID:Addgene_188682)
