p2151 pHAGE-hSPC-TFEB-TagBFP-W
(Plasmid
#188722)
-
PurposeLentiviral vector allowing for SFTPC-driven expression of TFEB:tagBFP fusion protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188722 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHAGE-EF1aL-eGFP-W
- Total vector size (bp) 12044
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTFEB
-
Alt nametranscription factor EB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1428
-
Entrez GeneTFEB (a.k.a. ALPHATFEB, BHLHE35, TCFEB)
- Promoter hSP-C
-
Tag
/ Fusion Protein
- tagBFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cctggacgactcactgctac
- 3′ sequencing primer aaatttGCGGCCGCgaccggtggatcccgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p2151 pHAGE-hSPC-TFEB-TagBFP-W was a gift from Darrell Kotton (Addgene plasmid # 188722 ; http://n2t.net/addgene:188722 ; RRID:Addgene_188722)