pMLS1272
(Plasmid
#188891)
-
PurposeRic-4 sgRNA expression vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188891 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescript II KS+
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePU6(R07E5.16)::Ric-4 sgRNA
-
gRNA/shRNA sequenceGAGAGGCTGGAATCAAAACTT
-
SpeciesC. elegans (nematode)
-
Entrez GeneCELE_Y22F5A.3 (a.k.a. CELE_Y22F5A.3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMLS1272 was a gift from Erik Jorgensen (Addgene plasmid # 188891 ; http://n2t.net/addgene:188891 ; RRID:Addgene_188891) -
For your References section:
High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. Schwartz ML, Davis MW, Rich MS, Jorgensen EM. PLoS Genet. 2021 Nov 8;17(11):e1009755. doi: 10.1371/journal.pgen.1009755. eCollection 2021 Nov. 10.1371/journal.pgen.1009755 PubMed 34748534