Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMLS719
(Plasmid #188894)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 188894 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMLS134
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PU6(K09B11.12)::miniMos Arm sgRNA
  • gRNA/shRNA sequence
    GACTGTCGAACCACCATAGTT
  • Species
    C. elegans (nematode)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMLS719 was a gift from Erik Jorgensen (Addgene plasmid # 188894 ; http://n2t.net/addgene:188894 ; RRID:Addgene_188894)
  • For your References section:

    High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. Schwartz ML, Davis MW, Rich MS, Jorgensen EM. PLoS Genet. 2021 Nov 8;17(11):e1009755. doi: 10.1371/journal.pgen.1009755. eCollection 2021 Nov. 10.1371/journal.pgen.1009755 PubMed 34748534