Skip to main content

pBAD-HisD-miniGFP2
(Plasmid #188897)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188897 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBAD
  • Backbone size w/o insert (bp) 4002
  • Total vector size (bp) 4332
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Arabinose administration for protein expression
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miniGFP2
  • Species
    Synthetic
  • Insert Size (bp)
    330
  • Promoter araBAD
  • Tag / Fusion Protein
    • 6xHis (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-HisD-miniGFP2 was a gift from Kiryl Piatkevich (Addgene plasmid # 188897 ; http://n2t.net/addgene:188897 ; RRID:Addgene_188897)
  • For your References section:

    Enhanced small green fluorescent proteins as a multisensing platform for biosensor development. Liang GT, Lai C, Yue Z, Zhang H, Li D, Chen Z, Lu X, Tao L, Subach FV, Piatkevich KD. Front Bioeng Biotechnol. 2022 Oct 17;10:1039317. doi: 10.3389/fbioe.2022.1039317. eCollection 2022. 10.3389/fbioe.2022.1039317 PubMed 36324888