pSLiP-G1
(Plasmid
#188963)
-
PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdown
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188963 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSEVA221
-
Backbone manufacturerVíctor de Lorenzo
- Backbone size w/o insert (bp) 3730
- Total vector size (bp) 10641
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namedCas9
-
SpeciesSynthetic
-
Insert Size (bp)6911
- Promoter PrhaBAD
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGGCAACCGAGCGTTC
- 3′ sequencing primer AGGGCGGCGGATTTGTCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA: atcggtcgcattgttttccactagg
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLiP-G1 was a gift from Seung-Goo Lee (Addgene plasmid # 188963 ; http://n2t.net/addgene:188963 ; RRID:Addgene_188963) -
For your References section:
CRISPRi-based programmable logic inverter cascade for antibiotic-free selection and maintenance of multiple plasmids. Kim SK, Kim H, Woo SG, Kim TH, Rha E, Kwon KK, Lee H, Lee SG, Lee DH. Nucleic Acids Res. 2022 Dec 9;50(22):13155-13171. doi: 10.1093/nar/gkac1104. 10.1093/nar/gkac1104 PubMed 36511859