Skip to main content

pSLiP-G1G2
(Plasmid #188965)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188965 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSEVA221
  • Backbone manufacturer
    Víctor de Lorenzo
  • Backbone size w/o insert (bp) 3730
  • Total vector size (bp) 10796
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    dCas9
  • Species
    Synthetic
  • Insert Size (bp)
    7066
  • Promoter PrhaBAD

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGGCAACCGAGCGTTC
  • 3′ sequencing primer AGGGCGGCGGATTTGTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLiP-G1G2 was a gift from Seung-Goo Lee (Addgene plasmid # 188965 ; http://n2t.net/addgene:188965 ; RRID:Addgene_188965)
  • For your References section:

    CRISPRi-based programmable logic inverter cascade for antibiotic-free selection and maintenance of multiple plasmids. Kim SK, Kim H, Woo SG, Kim TH, Rha E, Kwon KK, Lee H, Lee SG, Lee DH. Nucleic Acids Res. 2022 Dec 9;50(22):13155-13171. doi: 10.1093/nar/gkac1104. 10.1093/nar/gkac1104 PubMed 36511859