pT-GFP-rG2
(Plasmid
#188968)
-
PurposeIPTG inducible GFP with sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188968 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTrc99A
- Backbone size w/o insert (bp) 4124
- Total vector size (bp) 5194
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGFP
-
SpeciesSynthetic
-
Insert Size (bp)1070
- Promoter Ptrc
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tatggctgtgcaggtcgtaa
- 3′ sequencing primer gagaccccacactaccatcg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA: agtccatgtaatcagcgtctactagt
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT-GFP-rG2 was a gift from Seung-Goo Lee (Addgene plasmid # 188968 ; http://n2t.net/addgene:188968 ; RRID:Addgene_188968) -
For your References section:
CRISPRi-based programmable logic inverter cascade for antibiotic-free selection and maintenance of multiple plasmids. Kim SK, Kim H, Woo SG, Kim TH, Rha E, Kwon KK, Lee H, Lee SG, Lee DH. Nucleic Acids Res. 2022 Dec 9;50(22):13155-13171. doi: 10.1093/nar/gkac1104. 10.1093/nar/gkac1104 PubMed 36511859