pcDNA4TO OM-eLIR
(Plasmid
#189004)
-
Purposemitophagy-inducing adaptor protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 189004 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA4TO
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOM-eLIR
-
SpeciesSynthetic
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GCGATGCAATTTCCTCATTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.02.22.481456v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA4TO OM-eLIR was a gift from Atsushi Hoshino (Addgene plasmid # 189004 ; http://n2t.net/addgene:189004 ; RRID:Addgene_189004) -
For your References section:
Liver lipophagy ameliorates nonalcoholic steatohepatitis through extracellular lipid secretion. Minami Y, Hoshino A, Higuchi Y, Hamaguchi M, Kaneko Y, Kirita Y, Taminishi S, Nishiji T, Taruno A, Fukui M, Arany Z, Matoba S. Nat Commun. 2023 Jul 13;14(1):4084. doi: 10.1038/s41467-023-39404-6. 10.1038/s41467-023-39404-6 PubMed 37443159