pCAGGS-hCD4-GCaMP2
(Plasmid
#18932)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 18932 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 5900
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehCD4-GCaMP2
-
Alt nameCD4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2630
-
Entrez GeneCD4 (a.k.a. CD4mut, IMD79, Leu-3, OKT4D, T4)
-
Tag
/ Fusion Protein
- His (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer ggttcggcttctggcgtgtgacc
- 3′ sequencing primer TCC TTA AAC CTG TCT TGT AA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Synthetic construct fused with human CD4.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS-hCD4-GCaMP2 was a gift from Karel Svoboda (Addgene plasmid # 18932 ; http://n2t.net/addgene:18932 ; RRID:Addgene_18932) -
For your References section:
Characterization and subcellular targeting of GCaMP-type genetically-encoded calcium indicators. Mao T, O'Connor DH, Scheuss V, Nakai J, Svoboda K. PLoS ONE. 2008 . 3(3):e1796. 10.1371/journal.pone.0001796 PubMed 18350138