pNS3_Ptrc::lasR_Plas::mNG
(Plasmid
#189573)
-
PurposeFluorescent reporter for Las activation by 3OC12-HSL
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 189573 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHN1_lacUV5
- Backbone size w/o insert (bp) 4861
- Total vector size (bp) 6453
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTranscriptional activator lasR
-
Alt namelasR
-
SpeciesPseudomonas aeruginosa
-
Insert Size (bp)723
- Promoter trc
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcgggaatcgtagcaaagtc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMonomeric Neon Green
-
Alt namemNG
-
Insert Size (bp)711
- Promoter las
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer na
- 3′ sequencing primer cggtgagctggtgatatgggat
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNS3_Ptrc::lasR_Plas::mNG was a gift from Daniel Ducat (Addgene plasmid # 189573 ; http://n2t.net/addgene:189573 ; RRID:Addgene_189573) -
For your References section:
Developing Cyanobacterial Quorum Sensing Toolkits: Toward Interspecies Coordination in Mixed Autotroph/Heterotroph Communities. Kokarakis EJ, Rillema R, Ducat DC, Sakkos JK. ACS Synth Biol. 2023 Jan 20;12(1):265-276. doi: 10.1021/acssynbio.2c00527. Epub 2022 Dec 27. 10.1021/acssynbio.2c00527 PubMed 36573789