pBbA2C_Ptet::lasI
(Plasmid
#189576)
-
PurposeLas synthase (3OC12-HSL)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 189576 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBbA2C
- Backbone size w/o insert (bp) 3287
- Total vector size (bp) 3218
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAcyl-homoserine-lactone synthase
-
Alt nameluxI
-
SpeciesPseudomonas aeruginosa
-
Insert Size (bp)609
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACCACTCCCTATCAGTGATAGAG
- 3′ sequencing primer AAGGCCCAGTCTTTCGACTGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbA2C_Ptet::lasI was a gift from Daniel Ducat (Addgene plasmid # 189576 ; http://n2t.net/addgene:189576 ; RRID:Addgene_189576) -
For your References section:
Developing Cyanobacterial Quorum Sensing Toolkits: Toward Interspecies Coordination in Mixed Autotroph/Heterotroph Communities. Kokarakis EJ, Rillema R, Ducat DC, Sakkos JK. ACS Synth Biol. 2023 Jan 20;12(1):265-276. doi: 10.1021/acssynbio.2c00527. Epub 2022 Dec 27. 10.1021/acssynbio.2c00527 PubMed 36573789