pBAD/HisB (TIREVOL)-sfGFP
(Plasmid
#189675)
-
Purposetitratable expression of sfGFP in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 189675 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBAD/HisB
-
Backbone manufacturerThermo
- Total vector size (bp) 4788
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfGFP
-
SpeciesSynthetic
- Promoter pBAD
-
Tag
/ Fusion Protein
- His-T7-EK (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer atgccatagcatttttatcc
- 3′ sequencing primer gatttaatctgtatcagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD/HisB (TIREVOL)-sfGFP was a gift from Daniel Daley (Addgene plasmid # 189675 ; http://n2t.net/addgene:189675 ; RRID:Addgene_189675) -
For your References section:
Signal amplification of araC pBAD using a standardized translation initiation region. Shilling PJ, Khananisho D, Cumming AJ, Soderstrom B, Daley DO. Synth Biol (Oxf). 2022 Jul 5;7(1):ysac009. doi: 10.1093/synbio/ysac009. eCollection 2022. 10.1093/synbio/ysac009 PubMed 35903559