pPpT4- TEF2prom-TIR1-FLAG
(Plasmid
#189726)
-
PurposeEnables expression of OsTIR1 from the TEF2 promoter, used to implement the AID system in Komagataella phaffii (original name pLL002)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 189726 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPpT4
-
Backbone manufacturerNäätsaari et al., 2012
-
Vector typeYeast Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOsTIR1
- Promoter TEF2
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctttgtctcaggagatccgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPpT4- TEF2prom-TIR1-FLAG was a gift from Anita Emmerstorfer-Augustin (Addgene plasmid # 189726 ; http://n2t.net/addgene:189726 ; RRID:Addgene_189726) -
For your References section:
Applying the auxin-based degron system for the inducible, reversible and complete protein degradation in Komagataella phaffii. Lehmayer L, Bernauer L, Emmerstorfer-Augustin A. iScience. 2022 Aug 6;25(9):104888. doi: 10.1016/j.isci.2022.104888. eCollection 2022 Sep 16. 10.1016/j.isci.2022.104888 PubMed 36043049