Skip to main content

pLenti-ALDH1A3gRNA3
(Plasmid #189748)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 189748 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-v1
  • Total vector size (bp) 8324
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ALDH1A3 gRNA
  • gRNA/shRNA sequence
    tgaacttgacctccaggttg
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBl (unknown if destroyed)
  • 3′ cloning site BsmBl (unknown if destroyed)
  • 5′ sequencing primer N/A
  • 3′ sequencing primer N/A
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-ALDH1A3gRNA3 was a gift from Robert Sobol (Addgene plasmid # 189748 ; http://n2t.net/addgene:189748 ; RRID:Addgene_189748)
  • For your References section:

    A specific inhibitor of ALDH1A3 regulates retinoic acid biosynthesis in glioma stem cells. Li J, Garavaglia S, Ye Z, Moretti A, Belyaeva OV, Beiser A, Ibrahim M, Wilk A, McClellan S, Klyuyeva AV, Goggans KR, Kedishvili NY, Salter EA, Wierzbicki A, Migaud ME, Mullett SJ, Yates NA, Camacho CJ, Rizzi M, Sobol RW. Commun Biol. 2021 Dec 21;4(1):1420. doi: 10.1038/s42003-021-02949-7. 10.1038/s42003-021-02949-7 PubMed 34934174