pGEL639
(Plasmid
#189833)
-
Purpose(Empty Backbone) The T-DNA backbone of Cas12j2 for DNA methylation-based gene silencing in rice
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 189833 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLGE635
-
Backbone manufacturerShishiliu
- Backbone size (bp) 15480
-
Modifications to backboneadd Dnmt3A-Dnmt3L and KRAB domains
-
Vector typeCRISPR ; T-DNA clone
- Promoter ZmUbi1
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctttgtgcagagactgatgtggg
- 3′ sequencing primer ttctaataaacgctcttttctct
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: This plasmid contains an IS4-like element inserted within the backbone. This element is located outside of the LB-TDNA repeat and RB-TDNA repeat regions. This insertion is not expected to impact the plasmid's functionality in plants.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEL639 was a gift from Yong Zhang (Addgene plasmid # 189833 ; http://n2t.net/addgene:189833 ; RRID:Addgene_189833) -
For your References section:
Hypercompact CRISPR-Cas12j2 (CasPhi) enables genome editing, gene activation, and epigenome editing in plants. Liu S, Sretenovic S, Fan T, Cheng Y, Li G, Qi A, Tang X, Xu Y, Guo W, Zhong Z, He Y, Liang Y, Han Q, Zheng X, Gu X, Qi Y, Zhang Y. Plant Commun. 2022 Sep 20:100453. doi: 10.1016/j.xplc.2022.100453. 10.1016/j.xplc.2022.100453 PubMed 36127876