ISA431: aTc-MP6
(Plasmid
#189935)
-
PurposeMutagenesis Plasmid: pTet, danQ926, dam, seqA, emrR, ugi and cda1, tetR, CloDF13, KanR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 189935 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCloDF13, KanR
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsCan also use NEB 10-beta for transformation, grow in LB media with 1% glucose
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedanQ926, dam, seqA, emrR, ugi and cda1
- Promoter pTet
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctggtctcccgcttaacgat
- 3′ sequencing primer agtcagtgagcgaggaagca
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was constructed using MP6 (Plasmid #69669) and pAJM.011 (addgene #108529).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ISA431: aTc-MP6 was a gift from Nathan Crook (Addgene plasmid # 189935) -
For your References section:
Inducible directed evolution of complex phenotypes in bacteria. Al'Abri IS, Haller DJ, Li Z, Crook N. Nucleic Acids Res. 2022 Jun 10;50(10):e58. doi: 10.1093/nar/gkac094. 10.1093/nar/gkac094 PubMed 35150576