Skip to main content
Addgene

ISA431: aTc-MP6
(Plasmid #189935)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 189935 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CloDF13, KanR
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Can also use NEB 10-beta for transformation, grow in LB media with 1% glucose
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    danQ926, dam, seqA, emrR, ugi and cda1
  • Promoter pTet

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctggtctcccgcttaacgat
  • 3′ sequencing primer agtcagtgagcgaggaagca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was constructed using MP6 (Plasmid #69669) and pAJM.011 (addgene #108529).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ISA431: aTc-MP6 was a gift from Nathan Crook (Addgene plasmid # 189935 ; http://n2t.net/addgene:189935 ; RRID:Addgene_189935)
  • For your References section:

    Inducible directed evolution of complex phenotypes in bacteria. Al'Abri IS, Haller DJ, Li Z, Crook N. Nucleic Acids Res. 2022 Jun 10;50(10):e58. doi: 10.1093/nar/gkac094. 10.1093/nar/gkac094 PubMed 35150576